Community structure of coral microbiomes is dependent on host morphology - Microbiome

8/8/2022 6:00:00 PM

A study published in @MicrobiomeJ reports on the significant effect morphology has on the overall community structure of the microbiome in corals. Read the paper here:

Coral, 16S Rrna Gene

A study published in MicrobiomeJ reports on the significant effect morphology has on the overall community structure of the microbiome in corals. Read the paper here:

Background The importance of symbiosis has long been recognized on coral reefs, where the photosynthetic dinoflagellates of corals ( Symbiodiniaceae ) are the primary symbiont. Numerous studies have now shown that a diverse assemblage of prokaryotes also make-up part of the microbiome of corals. A subset of these prokaryotes is capable of fixing nitrogen, known as diazotrophs, and is also present in the microbiome of scleractinian corals where they have been shown to supplement the holobiont nitrogen budget. Here, an analysis of the microbiomes of 16 coral species collected from Australia, Curaçao, and Hawai’i using three different marker genes (16S rRNA, nifH, and ITS2) is presented. These data were used to examine the effects of biogeography, coral traits, and ecological life history characteristics on the composition and diversity of the microbiome in corals and their diazotrophic communities. Results The prokaryotic microbiome community composition (i.e., beta diversity) based on the 16S rRNA gene varied between sites and ecological life history characteristics, but coral morphology was the most significant factor affecting the microbiome of the corals studied. For 15 of the corals studied, only two species Pocillopora acuta and Seriotopora hystrix, both brooders, showed a weak relationship between the 16S rRNA gene community structure and the diazotrophic members of the microbiome using the nifH marker gene, suggesting that many corals support a microbiome with diazotrophic capabilities. The order Rhizobiales, a taxon that contains primarily diazotrophs, are common members of the coral microbiome and were eight times greater in relative abundances in Hawai’i compared to corals from either Curacao or Australia. However, for the diazotrophic component of the coral microbiome, only host species significantly influenced the composition and diversity of the community. Conclusions The roles and interactions between members of the coral holobiont are still not well unde

Coral processing and gDNA extractionCoral tissues were rinsed with sterile 1× phosphate-buffered saline (PBS) using an airbrush at a distance of 10–20 cm for ~ 30 s on corals hanging upside down to remove as much coral mucous as possible with its associated microbes and other cellular debris. Coral tissues were then removed from the skeleton using pressurized air (~130–150 psi) from a blow gun with sterile tips into a sterile bag (Whirlpak®, Nasco). The blow-gun tip was wiped clean with 70% ethanol followed by sterile 1× PBS between each sample. The tissue blastate was homogenized for 30 s at medium speed using a hand-held, variable speed, tissue homogenizer (BioSpec, Tissue-Tearor®) which was run in 70% ethanol followed by sterile 1× PBS between each sample. This coral homogenate was then separated into the host, Symbiodiniaceae, and bacterial fractions as follows: the coral homogenate containing coral tissue, Symbiodiniacaea, bacteria, and skeletal debris was gently pelleted (400 ×

Read more:
BMC »

LEEDS 2023: Get creative to win tickets to The Awakening

GET creative to win tickets to The Awakening - an unmissable live show which will launch LEEDS 2023 Year of Culture. Read more >>

Spintronics, 2D Materials, and the Future of QuantumTwo-dimensional (2D) materials have been drawing tremendous attention in spintronics because of their distinctive spin-dependent properties.

Man fined £18,000 for illegal River Thames developmentSimon Courtney-Worthy is ordered to pay by magistrates after breaching council enforcement notices. So if he was fined for 'harming a conservation area' how much should water companies that pump millions of gallons of raw sewage into the rivers be fined Or maybe a pile of wooden decking is greater harm? I understand the fines but why was there a victim surcharge? Who's the victim?

Demos, have-a-go sessions and wrestling in sumo suits at Daventry Emergency Services Fun DayPlenty of free fun to keep kids entertained as 999 services get together on Wednesday Northamptonshire

Step Inside London’s Finest Historical Italian CaffsCaffs are about shelter as much as they are about food. They’re places to eat something simple, without spending much or being moved along

Belfast group running free CPR lessons to teach public vital skillTheir next Community CPR Initiative event will be at the Kennedy Centre on August 20

Uganda LGBT rights: Government shuts down key advocacy groupSexual Minorities Uganda (Smug) decried the move as a 'witch hunt' targeting the LGBT community. No, no way, really, you don't say, uh huh, oh yeah, really, oh wow, no way, etc, etc... Is sexuality still illegal in uganda?

].By Cvetelin Vasilev, Ph.Image caption, The illegal development was build on the banks of the River Thames in Long Wittenham A man who built an illegal development on the banks of the River Thames and failed to pull it down has been fined.apply.

Coral processing and gDNA extraction Coral tissues were rinsed with sterile 1× phosphate-buffered saline (PBS) using an airbrush at a distance of 10–20 cm for ~ 30 s on corals hanging upside down to remove as much coral mucous as possible with its associated microbes and other cellular debris. Coral tissues were then removed from the skeleton using pressurized air (~130–150 psi) from a blow gun with sterile tips into a sterile bag (Whirlpak®, Nasco).Aug 8 2022 Spintronics is an emerging technology that exploits the intrinsic quantum properties of particles like the electron, and the associated particle angular moment, called spin, in addition to the particle's electric charge. The blow-gun tip was wiped clean with 70% ethanol followed by sterile 1× PBS between each sample. But he failed to comply with two enforcement notices. The tissue blastate was homogenized for 30 s at medium speed using a hand-held, variable speed, tissue homogenizer (BioSpec, Tissue-Tearor®) which was run in 70% ethanol followed by sterile 1× PBS between each sample.com The dynamic control of the electron spin offers possibilities for creating novel quantum-mechanical devices, such as spin transistors, spin valves, and high-density memory. This coral homogenate was then separated into the host, Symbiodiniaceae, and bacterial fractions as follows: the coral homogenate containing coral tissue, Symbiodiniacaea, bacteria, and skeletal debris was gently pelleted (400 × g , 5 min, 4°C).”.

From this homogenate, a 2-ml aliquot of the bacteria-enriched supernatant was removed and pelleted in a fixed-angle centrifuge (20,000 × g, 10 min).  What Is Spintronics? Conventional electronic devices rely on the generation, transport, manipulation, and detection of electric charge carriers, such as electrons and holes. He admitted two counts of failing to comply with an enforcement notice at Oxford Magistrates' Court on 28 July. This cell pellet was fixed in DNA buffer [ ] and used for 16S rRNA and nif H gene analysis and stored at −20°C as the bacterial fraction which would include bacteria from the host, the skeletal debris, and the phycosphere of the Symbiodiniaceae. The remaining homogenate was remixed and an aliquot (~2 ml) containing the coral tissue and Symbiodiniaceae cells was pelleted (4000 × g , 10 min, 4°C). The electrons exist either in spin-up or spin-down states, which can represent 0s and 1s in logic operations. The supernatant containing the host fraction was discarded and the pellets were remixed in 0. Follow BBC South on.02% sodium dodecyl sulfate (SDS) in 1× PBS at room temperature and incubated for 30 min followed by three additional rinses with 1× PBS (4000 × g , 10 min, 4°C) to remove any residual SDS. In most materials, the spin-up and spin-down magnetic moments cancel each other, making them unsuitable for spintronic applications.

After the last rinse, a 2-ml sample of cleaned Symbiodiniaceae cells was collected, pelleted (4000 × g , 10 min, 4°C), preserved in 2 ml of DNA buffer, and stored at −20°C for ITS2 gene analysis as the Symbiodiniaceae fraction. For the Symbiodiniaceae fraction, no analysis using the 16S rRNA and nif H genes was conducted to capture the endosymbionts of the algal cells in this study. The spin state in these randomly scattered domains can be easily manipulated by the application of external magnetic fields. Genomic DNA (gDNA) was isolated from the preserved bacterial fractions described above, and the seawater and porewater filters using the MOBIO PowerSoil® DNA isolation kit following the manufacturer’s instructions with the addition of a 10-min 65°C heating step prior to two 2-min bead beating using a Qiagen QuickLyser set at 50 Megahertz for the bacterial analyses . Genomic DNA was extracted from Symbiodiniaceae fractions using the MOBIO PowerPlant® DNA isolation kit with modifications as previously described [ ]. Spintronics: The Technology Revolution You’ve Probably Never Heard OfPlay Video Credit: Seeker/YouTube. All bacterial and Symbiodiniaceae gDNA was checked for quality and concentration using a NanoDrop spectrophotometer 2000c.

Amplification of microbial 16S rRNA gene, nifH, and dinoflagellate ITS2 genes A total of 164 coral and environmental samples (Supplemental Table ) were polymerase chain reaction (PCR)-amplified with two primer sets to target the universal bacterial/archaeal 16S rRNA gene and nitrogenase gene (i. In such spintronic devices, the material's resistance or tunneling current in the system depends on the spin direction controlled by local magnetic fields.e., nif H). The two physical principles underlying the current interest in spintronics are the quantum-mechanical nature of the spin and the extended coherence time of the spin states. Linker primer sequences CS1 (5′ - ACACTGACGACATGGTTCTACA) and CS2 (5′ - TACGGTAGCAGAGACTTGGTCT) were added to the 5′ end of both forward and reverse primers to facilitate sequencing. The 16S rRNA gene was amplified from the bacterial pellet using updated Earth Microbiome degenerate primers designed to amplify the hypervariable region V4, consisting of the forward primer 515F (5′ - GTGYCAGCMGCCGCGGTAA [ . By actively manipulating the spin of the charge carrier particles with spin-dependent properties, researchers envisage that they can create spin transistors, spin filters, and new memory devices suitable for quantum information processing and computation.